SARS-CoV-2 Probe Set

Trình tự các primers và probes được cung cấp theo công bố của Tổ Chức Y Tế Thế Giới (World Health Organization_WHO)

STT   Tên Chiều 5' -> 3' Wet/Dry Lượng
1 RdRP_SARSr_F2 GTGARATGGTCATGTGTGGCGG Wet 5000 pmol
2 RdRP_SARSr_R1 CARATGTTAAASACACTATTAGCATA Wet 5000 pmol
3 RdRP_SARSr_P2 CAGGTGGAACCTCATCAGGAGATGC Wet 1000 pmol
5’-FAM-BHQ1-3’
4 RdRP_SARSr_P1 CCAGGTGGWACRTCATCMGGTGATGC Wet 1000 pmol
5’-FAM-BHQ1-3’
5 E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Wet 5000 pmol
6 E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA Wet 5000 pmol
7 E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG Wet 1000 pmol
5’-FAM-BHQ1-3’

 

Mã sản phẩm Tên Diễn giải Đơn giá (VAT) Số lượng Thành tiền
WHO_E_Sarbeco E_Sarbeco Bộ probe 200 test phát hiện gene E gồm 3 trình tự E_Sarbeco_F1; E_Sarbeco_R2; E_Sarbeco_P1 2.400.000
WHO_RdRP RdRP Bộ probe gồm 200 phản ứng phát hiện gene RdRP gồm 4 trình tự RdRP_SARSr_F2; RdRP_SARSr_R1; RdRP_SARSr_P2; RdRP_SARSr_P1 4.400.000
Tổng cộng: